rs309248 chr18:68715237 T>C
- Sequence
cttaagaatcctttgcgctctcgg[T/C]gcccccctccacgcccaggagcgt
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) breast tumor 22RV1 (prostate carcinoma) HepG2 (hepatoblastoma)
- ASB for transcription factors
- SUH_HUMAN TYY1_HUMAN HNRLL_HUMAN NOTC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SUH_HUMAN | 1.49 | 0.82 | 1.50 | n/a | No Hit | |||
| TYY1_HUMAN | 2.24 | -2.06 | 1.00 | n/a | No Hit | |||
| HNRLL_HUMAN | -2.24 | 2.50 | 1.00 | n/a | n/a | |||
| NOTC1_HUMAN | 1.94 | -4.61 | 2.00 | n/a | n/a | |||
| ANDR_HUMAN | 2.54 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood