rs310597 chr7:151175959 A>G
- Sequence
gctttcaggccctctcaaaaggcc[A/G]tggacatctggaaggagaggtttg
- ASB in cell types
- foreskin keratinocyte HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.45 | 2.80 | 2.00 | |||
| HeLa S3 (cervical adenocarcinoma) | 3.34 | -0.42 | 1.83 |
Items per page:
1 – 2 of 2