rs310619 chr20:63496168 G>A
- Sequence
tccagcacccccttgctctccgtc[G/A]gggtcctgggacgccggccccctc
- ASB in cell types
- HeLa (cervical adenocarcinoma) GSC23 (Glioblastoma) foreskin keratinocyte SMMC-7721 (hepatocellular carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | -2.17 | 1.40 | 1.33 | |||
| GSC23 (Glioblastoma) | n/a | 1.94 | 3.00 | |||
| foreskin keratinocyte | 0.57 | n/a | 2.33 | |||
| SMMC-7721 (hepatocellular carcinoma) | n/a | 1.98 | 3.00 | |||
| HeLa S3 (cervical adenocarcinoma) | -0.45 | 1.31 | 3.00 |
Items per page:
1 – 5 of 5