rs311224 chr6:107083536 C>A
- Sequence
ctgcagtcccagatatttgggagg[C/A]tgaggtgggaagatccactgagcc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- PAX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PAX2_HUMAN | -4.09 | 3.06 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1