rs313324 chr12:104583032 A>C
- Sequence
acagctttttaatttgcctgcaca[A/C]atagacctgcctggccaacttgga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) germinal center B-cells
- ASB for transcription factors
- SMCA5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA5_HUMAN | -1.83 | 2.22 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1