rs31534 chr5:135945381 T>A
- Sequence
ggatgattatttggaaaactaagc[T/A]tatattttattgtgcaaatatttc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM18526 (B – cells Lymphoblastoid Cell Lines) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 1.43 | -0.16 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.53 | -0.19 | 1.00 | |||
| foreskin keratinocyte | 1.32 | -4.72 | 2.67 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Spleen, Thyroid