rs316409 chr5:43065367 G>T
- Sequence
ccaaaaaaaaatttttttttttga[G/T]tatacaaaacatacaaagcatcct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) primary B-CLL cells spleen
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.60 | 0.90 | 1.07 | |||
| primary B-CLL cells | 1.58 | -0.65 | 1.50 | |||
| spleen | -0.85 | 1.91 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Pituitary, Stomach, Testis