rs31909 chr5:14810101 C>G
- Sequence
tctacaggagggaagaagcaattt[C/G]caattctgagcttcatgagggagg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 2.17 | -0.80 | 1.50 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | n/a | 1.96 | 1.00 |
Items per page:
1 – 2 of 2