rs322755 chr7:128135662 A>C
- Sequence
cagcggcgagagcgtgagagggga[A/C]gagctgggggtccgggccaaaagg
- ASB in cell types
- HEK293 (embryonic kidney) hepatocytes GM12878 (female B-cells lymphoblastoid cell line) MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.06 | 0.72 | 1.99 | |||
| hepatocytes | 2.27 | -2.27 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.51 | 0.85 | 1.03 | |||
| MCF7L-P(immortalized breast epithelial cell line) | 0.24 | 2.65 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg