rs322907 chr1:199113428 T>G
- Sequence
cttgctaagtagttctaccagatg[T/G]cagtggcagcctggaaaggtatcg
- ASB in cell types
- T47D (invasive ductal carcinoma) THP-1 (acute monocytic leukemia) hASC (preadipocytes)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.63 | 1.28 | 1.06 | |||
| THP-1 (acute monocytic leukemia) | 1.04 | 0.39 | 2.00 | |||
| hASC (preadipocytes) | 1.71 | -0.43 | 1.00 |
Items per page:
1 – 3 of 3