rs324018 chr12:57093946 T>G
- Sequence
ggggagcaggctaggagttgtggg[T/G]atggggatggggatgcccagcttg
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.41 | -0.13 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.77 | 0.85 | 1.02 |
Items per page:
1 – 2 of 2