rs325437 chr12:32369315 C>T
- Sequence
tgatggtgccagacctcagtagtc[C/T]ggttgtggttttcatcatctgctc
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | -0.15 | 1.82 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, cystatin c in serum, fasting blood glucose, mitral annular calcium, obesity with early age of onset (age >2), schizophrenia, spine bone mineral density (bmd), variant creutzfeldt-jakob disease