rs328185 chr18:46658264 C>T
- Sequence
gtcggcactcacaggcctccccgg[C/T]agcctggggcagctttggtcctgc
- ASB in cell types
- glioblastoma cells Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 1.59 | n/a | 2.00 | |||
| Peyer's patch | 1.71 | -0.66 | 1.00 |
Items per page:
1 – 2 of 2