rs329120 chr5:134526066 C>T
- Sequence
gcgcatctccacgacgttatttgg[C/T]gtttttgcaacagatctgccagcg
- ASB in cell types
- HS-ES-2M (Epithelioid sarcoma) HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-ES-2M (Epithelioid sarcoma) | -0.93 | 1.39 | 1.00 | |||
| HCT-116 (colon carcinoma) | 0.98 | 0.15 | 1.00 |
Items per page:
1 – 2 of 2