rs333097 chr18:7177385 G>T
- Sequence
ctagctaacaggaaccctgtgaag[G/T]gagcacaaattcagatttaaacct
- ASB in cell types
- glioblastoma patient-derived cell model foreskin keratinocyte GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma patient-derived cell model | n/a | 3.59 | 2.00 | |||
| foreskin keratinocyte | 0.84 | n/a | 2.83 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 1.30 | -1.79 | 1.33 |
Items per page:
1 – 3 of 3