rs33355 chr5:68649043 A>G
- Sequence
gacattttccattgatggctctca[A/G]taaaaccagaaatactttgtgctt
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 0.07 | 2.80 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, acute interstitial lung disease in gefitinib-treated non-small cell lung cancer, chronic kidney disease, hypertension (early onset hypertension), hypertension, combined control dataset, ldl cholesterol change with statins, maternal transmission distortion, salmonella-induced pyroptosis, serum creatinine, simpson-angus scale, stabilized warfarin dose, total cholesterol change with statins