rs33510 chr3:42349988 A>G
- Sequence
agaatcccctgggttttttagcaa[A/G]agataacgcaactgctaaaacaac
- ASB in cell types
- HUES64 (embryonic stem cells)
- ASB for transcription factors
- GATA6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA6_HUMAN | 2.89 | 0.88 | 1.25 | 1.68 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
