rs337182 chr1:220733282 C>A
- Sequence
ctcgtgtaaatccggagcaactgc[C/A]cgggaaatcccccgtctaacccgg
- ASB in cell types
- L1236 (Hodgkin lymphoma) GM18526 (B – cells Lymphoblastoid Cell Lines) breast tumor glioblastoma cells
- ASB for transcription factors
- NFKB1_HUMAN TF65_HUMAN STAG1_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFKB1_HUMAN | 0.16 | 4.69 | 1.75 | n/a | No Hit | |||
| TF65_HUMAN | 1.21 | -0.83 | 1.80 | -1.44 | Weak Concordant | |||
| STAG1_HUMAN | 0.01 | 0.79 | 1.05 | n/a | n/a | |||
| ESR1_HUMAN | 2.54 | n/a | 2.00 | n/a | No Hit | |||
| RAD21_HUMAN | 0.87 | 0.91 | 1.07 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, hip bone mineral density (bmd), partial epilepsy, triglycerides, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood