rs338853 chr5:112529826 G>T
- Sequence
cagcttactctccccagttcaccc[G/T]ttctctccaggtgatcgcatgtgg
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -1.25 | 1.65 | 1.00 | |||
| LNCaP (prostate carcinoma) | 1.09 | -0.85 | 1.00 |
Items per page:
1 – 2 of 2