rs33959 chr5:142548931 G>T
- Sequence
gggctaaatgcaaacgatctctgt[G/T]tgtcctgaaatcatctgggataat
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) upper lobe of left lung HeLa Kyoto (cervical adenocarcinoma) foreskin keratinocyte
- ASB for transcription factors
- STAG1_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.09 | -0.41 | 1.00 | n/a | n/a | |||
| SMC3_HUMAN | 0.26 | 1.43 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2