rs34061869 chr1:151071113 G>A
- Sequence
ggggacggggaggaaggggatgct[G/A]tcgggaggaaggggaggggactgg
- ASB in cell types
- T47D (invasive ductal carcinoma) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.00 | 0.46 | 1.16 | |||
| SK-N-SH (neuroblastoma) | 1.60 | -1.41 | 1.00 |
Items per page:
1 – 2 of 2