rs340648 chr4:87019788 A>G
- Sequence
gtgtttccttgagttctgtgagcc[A/G]ctccagcaaattaattgaaaccgt
- ASB in cell types
- MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 2.00 | -0.99 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Esophagus_Muscularis, Muscle_Skeletal, Testis, Thyroid