rs34089598 chr4:38675606 A>C
- Sequence
tgtgatacccacataaaatgatta[A/C]tagaattcctgagcctggttaaaa
- ASB in cell types
- RH4 (alveolar rhabdomyosarcoma) K562 (myelogenous leukemia) OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RH4 (alveolar rhabdomyosarcoma) | -0.14 | 2.29 | 1.11 | |||
| K562 (myelogenous leukemia) | 0.71 | 0.08 | 2.01 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 1.49 | -0.73 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Brain_Putamen_basal_ganglia, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood