rs34116853 chr20:48877357 A>C
- Sequence
ggtctagaatgacttcaggcatgg[A/C]tagatctaggagtcaaagaacatc
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) glioblastoma patient-derived cell model
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -4.72 | 4.20 | 1.17 | n/a | n/a | |||
| CTCF_HUMAN | 0.05 | 2.86 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI highest math class taken (mtag), self-reported math ability, self-reported math ability (mtag)
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid