rs34124 chr7:31648497 A>G
- Sequence
tccaaataaccagaagatggcagc[A/G]tttcagaatcttccacatccctcc
- ASB in cell types
- foreskin keratinocyte heart left ventricle
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.54 | 1.65 | 1.28 | |||
| heart left ventricle | 2.17 | -1.74 | 1.00 |
Items per page:
1 – 2 of 2