rs34132287 chr2:112049512 G>A
- Sequence
ttgccaggcggaccgtggtctagt[G/A]gtagcgtaagtgtcaaggaaaaac
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) HeLa (cervical adenocarcinoma) MCF7 (Invasive ductal breast carcinoma) adrenal gland
- ASB for transcription factors
- CTCF_HUMAN KDM6A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.63 | 0.37 | 1.37 | -3.08 | Concordant | |||
| KDM6A_HUMAN | 2.71 | -1.91 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood