rs34148247 chr6:130282371 A>T
- Sequence
aaatacatgttatatatattatat[A/T]cataggcaagtataaatgcatagt
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM17942 (lymphoblastoid cell) RWPE2 GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 0.89 | -0.94 | 1.00 | |||
| GM17942 (lymphoblastoid cell) | 2.09 | -1.85 | 1.00 | |||
| RWPE2 | 2.69 | -2.43 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.08 | -0.38 | 1.00 | |||
| foreskin keratinocyte | 1.14 | -2.21 | 1.83 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cortex, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg