rs34162779 chr5:122775477 T>G
- Sequence
cgaaccgagcattgcagcggcgct[T/G]tcccagctcagctggccttcctcg
- ASB in cell types
- BIN-67 (Ovarian small cell carcinoma, hypercalcemic type)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BIN-67 (Ovarian small cell carcinoma, hypercalcemic type) | -0.37 | 1.74 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid