rs34173062 chr8:144103704 G>A
- Sequence
tgcacagccaagagcactgcggcg[G/A]agcccaagtccgaggccgccgccg
- ASB in cell types
- 22RV1 (prostate carcinoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.24 | -4.18 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI eosinophil counts, eosinophil percentage of granulocytes, eosinophil percentage of white cells, neutrophil percentage of granulocytes, respiratory diseases, sum eosinophil basophil counts
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Lung, Nerve_Tibial, Testis, Thyroid, Whole_Blood