rs34173919 chr13:24074895 C>T
- Sequence
ggaaagggaagtaaggcacagaca[C/T]agctaggctgggtgcagtttggca
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.10 | 0.20 | 2.00 | |||
| monocyte-derived dendritic cells | -0.38 | 2.04 | 1.00 |
Items per page:
1 – 2 of 2