rs34192225 chr21:13980457 A>G
- Sequence
aacctctgccgccacctgcagggc[A/G]ccccctgatagcgcccctaacccg
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -1.85 | 2.15 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood