rs34206657 chr19:47514700 C>T
- Sequence
ggccctcagcctgcgtcccctctg[C/T]cgcctcaggccatgtcaccttatt
- ASB in cell types
- K562 (myelogenous leukemia) primary B-CLL cells adrenal gland
- ASB for transcription factors
- CTCF_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.28 | 0.01 | 1.19 | n/a | No Hit | |||
| BRD4_HUMAN | 2.79 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood