rs342293 chr7:106731773 C>G
- Sequence
gggcagccctgtggttttaattat[C/G]ttgaggttcaggctcaccagtgct
- ASB for transcription factors
- IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 1.90 | -0.48 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP decreased binding of annexin v to platelets activated with collagen-related peptide, decreased platelet reactivity measured as the level of fibrinogen binding, hemoglobin (hb), ldl cholesterol, mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), mean platelet volume (mpv), mean platelet volume (mpv) (fl), log, platelet aggregation in response to adp ec50/10um, platelet aggregation in response to adp ec50/2um, platelet aggregation in response to epinephrine 1um/2um, platelet aggregation in response to epinephrine ec50, platelet aggregation in response to epinephrine ec50/10um, platelet count, platelet count (plt), platelet count (plt) (10^9/l), total cholesterol, triglycerides, white blood cell count (wbc)