rs34234400 chr15:93018736 C>G
- Sequence
gccagcagttcttggcgttcttga[C/G]tcacgccgatttctgcctccatct
- ASB in cell types
- foreskin keratinocyte gastroesophageal sphincter PANC1 (pancreatic ductal adenocarcinoma) esophagus squamous epithelium
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -4.14 | 1.96 | 2.17 | |||
| gastroesophageal sphincter | 2.33 | -1.93 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | -1.46 | 1.52 | 1.50 | |||
| esophagus squamous epithelium | -2.02 | 2.17 | 1.00 | |||
| LUHMES (lund human mesencephalic cells) | 1.57 | -1.02 | 1.00 |
Items per page:
1 – 5 of 5