rs34234937 chr12:76470702 A>C
- Sequence
actgattagtatatcacactgcac[A/C]gcatcaagccacaggcaagactgc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.93 | 0.17 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.94 | 0.21 | 1.12 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Heart_Atrial_Appendage, Heart_Left_Ventricle, Skin_Sun_Exposed_Lower_leg, Whole_Blood