rs34236168 chr8:26662021 T>C
- Sequence
gctggagacacacacctcttacct[T/C]tttttttgttttgaaacagggtct
- ASB in cell types
- GM17942 (lymphoblastoid cell) MCF10AT1 (breast premetastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | 0.84 | -0.84 | 1.00 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | -1.64 | 2.19 | 1.00 |
Items per page:
1 – 2 of 2