rs34241679 chr1:16032973 T>G
- Sequence
gctggatgttgggtcctgtccact[T/G]gcagccccgcccagacccttgagt
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte epithelial cell of proximal tubule
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.12 | 0.77 | 1.97 | |||
| foreskin keratinocyte | 0.56 | n/a | 2.33 | |||
| epithelial cell of proximal tubule | 2.21 | -1.89 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Thyroid