rs34250420 chr3:98188517 G>A
- Sequence
gtcttaataggggacagaataggt[G/A]ccttaagggaatgtaggaaccaaa
- ASB in cell types
- epithelial cell of prostate 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -2.33 | 2.58 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 0.22 | 2.75 | 1.00 |
Items per page:
1 – 2 of 2