rs34253825 chr7:32800670 G>A
- Sequence
ccttggtctagcagtaacgccagc[G/A]tctgggaagacacctgttgccaag
- ASB in cell types
- T47D (invasive ductal carcinoma) EOL-1 (Acute myeloid leukemia) IMR-5 (Neuroblastoma) erythroid cells
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN GATA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.68 | 0.41 | 1.30 | 0.37 | Weak Discordant | |||
| RAD21_HUMAN | 2.33 | 1.29 | 1.19 | n/a | n/a | |||
| GATA2_HUMAN | 3.02 | -3.01 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood