rs34260568 chr9:38682936 G>A
- Sequence
acctaacaagatgactcagaatgc[G/A]gctggtcatcataaagaccagaca
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) BIN-67 (Ovarian small cell carcinoma, hypercalcemic type)
- ASB for transcription factors
- SMRC1_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | -0.07 | 1.98 | 1.40 | n/a | n/a | |||
| SMCA4_HUMAN | -0.10 | 1.32 | 1.44 | n/a | n/a |
Items per page:
1 – 2 of 2