rs34277881 chr1:160194026 T>G
- Sequence
ccatacatacacacacacaccacc[T/G]gcatacacaccacacatatgcatg
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.03 | 0.85 | 2.10 | |||
| HEK293 (embryonic kidney) | 2.60 | -1.82 | 2.00 | |||
| pancreas | 2.06 | n/a | 1.00 |
Items per page:
1 – 3 of 3