rs34278882 chr9:116495249 T>G
- Sequence
ctagtggacacctgttggtttgac[T/G]ggctataaaggcatgcctctttct
- ASB in cell types
- PC9 (lung adenocarcinoma) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | 0.17 | 1.44 | 2.00 | |||
| T47D (invasive ductal carcinoma) | 0.58 | 1.11 | 1.10 |
Items per page:
1 – 2 of 2