rs34298786 chr15:39976851 G>A
- Sequence
cttctcccagtccttcctgtaagc[G/A]cacggcgcggaccagctgcctctg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) tibial nerve HepG2 (hepatoblastoma) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.02 | 1.07 | 2.03 | |||
| tibial nerve | 1.74 | -1.56 | 1.00 | |||
| HepG2 (hepatoblastoma) | 1.65 | -1.37 | 1.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 2.36 | -2.38 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood