rs34301003 chr17:38867488 C>T
- Sequence
ggattacaggcgtgagccactgtg[C/T]ccggcctatcttggcctagtcttt
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma) K562 (myelogenous leukemia) GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.46 | -1.13 | 1.48 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Stomach, Testis, Thyroid, Whole_Blood