rs34308817 chr3:181700413 G>T
- Sequence
atcggcgtcttaactattttggtg[G/T]tggttacgggtagggggaagttgc
- ASB in cell types
- GM23338 OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23338 | 2.49 | -2.10 | 1.00 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 0.02 | 1.69 | 1.00 |
Items per page:
1 – 2 of 2