rs34311924 chr2:38526320 T>C
- Sequence
attacatgtgctctttccctttga[T/C]ccagcaaccgcagttctaggagtc
- ASB in cell types
- JB6 (Human anaplastic large cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| JB6 (Human anaplastic large cell lymphoma) | -4.89 | 2.92 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Colon_Sigmoid, Colon_Transverse, Nerve_Tibial