rs34316527 chr19:19598992 A>G
- Sequence
agtgcaatggcgtgatcttggctc[A/G]ccgcacactcttgttgcccaggct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.73 | 0.71 | 1.11 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 2.07 | -1.49 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Colon_Transverse, Esophagus_Gastroesophageal_Junction, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood