rs34324881 chr3:149095673 G>A
- Sequence
acaaaacagaaaggggaacagaaa[G/A]agacaaaaattactaaactacaag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.73 | 0.88 | 1.07 | |||
| macrophages form periferal blood | 1.51 | -0.00 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Skin_Sun_Exposed_Lower_leg, Thyroid