rs34331927 chr3:134145362 G>C
- Sequence
actgaatctggtagctgtagtctg[G/C]agcctgcagagggagcagctccag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) neural progenitors epithelial cell of prostate SYO-1(Biphasic synovial sarcoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.28 | 2.29 | 1.46 | 1.35 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis