rs343481 chr9:6024285 C>G
- Sequence
cctccacggagttcaaaagtgcca[C/G]ttccactttgttccctcagcttta
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.74 | -0.46 | 1.72 | -2.14 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
